Sé que siempre lo voy a querer

Yo le conocí el 16 de marzo del 2010. Fuimos a la Mascletá de valencia unos cuantos amigos y el vino con dos amigos más, ellos eran amigos del novio de mi mejor amiga. Ese día no hablamos mucho como mucho dos palabras. Yo creía que no le volvería a ver nunca más.

Unas semanas después, por casualidad, lo vi por Tuenti y lo agregué. Empezamos a hablar cada día más, me decía que me fuera un día con él de fiesta o a su pueblo y yo le decía que cuando fuera mi amiga para ver a su novio yo iría. Un día como otro cualquiera de instituto mi mejor amiga me dijo que tenía que contarme algo de Vicente y le dije “Pues cuéntamelo” y me dijo que él le había dicho que quería estar conmigo porque yo le gustaba mucho. Yo no me lo creí, pero luego el me lo confirmo por Tuenti y ahí quedo la cosa.

Quedamos un jueves en encontrarnos en Nuevo Centro para dar una vuelta y apareció 40 minutos tarde. Yo estaba allí esperando con mi hermana y una amiga y llegó por poco lo mato, pero el corazón me iba a cien por hora. Llegó acompañado de dos amigos y una chica que yo no conocía.

Dos días después tuvimos un problema por una tercera persona (la chica) y pensé que era mejor olvidarme de él y no quería hacerme ilusiones. La semana siguiente celebraba mi cumpleaños y él estaba invitado era el sábado.

Un día antes fui con mi amiga para ver a su novio y yo para verlo a él, pero él no estaba. Yo enseguida pensé que no había querido ir que no quería verme y esas cosas. Mi hermana estaba conectada y lo vio conectarse y le preguntó “¿Tú no habías quedado con Macarena? Ella esta allí” y él se quedo extrañado, luego resultó que nadie lo había avisado de que iba y por eso no había venido. No sabía si se acordaría de la promesa de venir a mi cumpleaños y el sábado iba un poco triste. cuando llegue a la estación lo ví y me sonrió.

Mientras llegábamos a la playa él no me miraba ni siquiera sonreía, le daba miedo después del problema que habíamos tenido. Yo pensé que si le sacaba la lengua y le sonreía sabría que estaba perdonado, lo hice y me sonrió.

En la playa al principio no hablábamos mucho, tan solo nos mirábamos. Fuimos a pasear por la orilla: El novio de mi amiga, mi amiga, y otros dos amigos él y yo, mi amiga de broma le dijo: “Anda Vicente se un caballero y llévale la toalla a la chica”. Me intentó coger la toalla pero no lo consiguió y yo me reía de él y se picaba, la consiguió coger pero se la quite. Luego vimos a la parejita besándose y me suelta: “Porque tu no quieres que si no”. Yo me quedé sin saber que responder.

Después de comer me pregunto si quería ir a dar un paseo él y yo solos, le dije que si y de broma añadí: “¿Te dejas violar?” y me dijo “¡Tú prueba si quieres!… jajaja”.

Nos fuimos a una cabañita que había en la playa y nos sentamos en la puerta yo no sabía que decirle, estábamos los dos callados, yo solo sonreía. Él me tenia abrazada y no se con que tema pero empezamos a hablar. Se me estaba pasando el tiempo volando, no se cuanto llevábamos ahí y vi que se acercaban mi mejor amiga y su novio. Nos dijeron que estaban buscándonos, que mi hermana estaba asustada porque creía que Vicente me había hecho algo y los dos empezamos a reír. Mi mejor amiga me pregunto si me había besado con el y le dije que no; y su novio le preguntó a Vicente lo mismo y él le contesto que no.

Volvimos con los demás y de vez en cuando nos mirábamos y sonreíamos. Me cogió en los hombros y me tiro dentro del agua. Casi lo mato, estaba congelada y encima me había metido con ropa, pero me abrazó y se me olvido todo.

Cuando ya nos íbamos a ir llegaron unos amigos y llegó el momento de dar los regalos. Uno de los regalos eran unas esposas (regalo del novio de otra mejor amiga). Lo miré y me reí. Cuando íbamos en el metro me senté con los amigos que habían llegado últimos porque se habían quedado solos. Él me cogió de la mano y me dijo que me quedara sentada con el y me miraba con carita de niño bueno pero a mi me sabia mal por los otros chicos.

Luego el día 11 de mayo (cuando es realmente mi cumpleaños) vino a donde yo vivo para pasar ese día también conmigo. Estuvimos en un garaje viendo una película pero como no se nos ocurría ninguna decidimos ir al videoclub a ver cual cogíamos. Fuimos el y yo solos, el videoclub estaba vacío estábamos mirando películas cuando de repente me cogió del brazo me giró me miró a los ojos y me dio nuestro primer beso. Sentí mariposas. Quise que ese momento no acabara nunca. No cogimos ninguna película, fuimos a mi casa a por una y fuimos al garaje, yo iba muy feliz y se notaba en el brillo de los ojos.

Luego por Tuenti le pregunté que él y yo que éramos novios, amigos, ¿o que? porque no quería que jugara conmigo y me dijo que él y yo estábamos juntos que solo me quería para él, y que desde nuestra conversación en la cabaña de la playa él ya me consideraba su novia.

Y desde el 8 de mayo estamos juntos y siento que cada día lo quiero más es el amor de mi vida y sé que siempre lo voy a querer. ¡Él ya sabe que yo soy completamente suya!

Vicente, te amo.

Artículos relacionados

12 Responses to “Sé que siempre lo voy a querer”

  1. a eso me refiero amor con solos una miradas sin hablar se dicen todo que linda historia. sigan juntos por mucho tiempo ojala toda la vida tengas hijos disfruten los momentos que pasen juntos les deceo lo mejor y mucha felicidad….saludos 🙂

  2. guuuuaaaaaaauuuuuuuuu que historia tan romantica les deseo que sean muy felices……………

  3. Qee lendaa historiia!Me enqanto,enserio,aparte se conocieron el dia de mi quumplee (16 de marzo)suuerte chiiqos!

  4. Me alegro por ti hermosa! Por fin una historia lindaaa. la mía es un tanto parecida xD, te felicit y que sigan muchos años por delante juntos! 😉

  5. que lindo mensaje, me gusto muchisimo, es una historia mui linda y tan bn mui real de verda, uno como persona abeses, uno nesesita en comtral al amor de su vida, i que el amor sea verdadero, como la historia que esta escrita 😀

  6. le amo mas q a nada Responder

    Le conoci en un centro de menores, la cañada, cuendo el llego a mi modulo yo estaba peleada con la mayoria de los chicos y

  7. bueno que bueno que sean pareja que lindo el chico y te deseo lo mejor del mundo que seas muy pero muy feliz con vicente y coman perdices. ya quisiera que eso me pase ami espero que tambien me pase una historia bonita para ,mi cuando la tenga la copio para que la lean todos:P..

  8. la miaa es casii parecida hermosa tbm
    y muy linda

    pues suerte ninaa con tu boy vicente

    el amor eslindo cuando lo obtienes!!

  9. Waoo que hermoso es el amor , suerte con vicente .. eso es true love ( amor verdadero ) felicidades amiga .. que bellos es tener ah la persona que amas ah tu lado y saver que esa persona te valora y te respeta por lo que eres .. sigue haci espero que esten juntos hasta que dios los separe 🙂

Deja un comentario

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *